View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17523_low_31 (Length: 276)
Name: NF17523_low_31
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17523_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 6330423 - 6330665
Alignment:
| Q |
1 |
tcgtttcttcttgcttttttccatcttctttgacagagttagattgaaactttaaatcctgaaggtggttttgtttcttattactctataggctcacatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
6330423 |
tcgtttcttcttgcttttttccatcttctttgacagagttagattgaaactttaaatcctgaaggtggttttgtttcttattactctatagactcacttt |
6330522 |
T |
 |
| Q |
101 |
tatatactatatggtgggttacgtgggaatcccattaacatgcattggttgggggttctatatgggtgccaatagtaggttggaccaagttagatttaat |
200 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6330523 |
tatatactatatggtgggttacgttgcaatcccattaacatgcattggttggggcttctatatgggtggcaatagtaggttggaccaagttagatttaat |
6330622 |
T |
 |
| Q |
201 |
tgcgacattttccatgtttgatataaacttgcaaattattcca |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6330623 |
tgcgacattttccatgtttgatataaacttacaaattattcca |
6330665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University