View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17523_low_36 (Length: 252)
Name: NF17523_low_36
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17523_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 53 - 251
Target Start/End: Complemental strand, 23390940 - 23390742
Alignment:
| Q |
53 |
tgttctacaaccatttttattactagtactgattcatcatatatacctacgttgaaattgaaaagcaaattctttttgcattcttttctgtaatgcaggt |
152 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23390940 |
tgttctacaaccatttttattagtagtactgattcttcatatatacatatgttgaaattgaaaagcaaattctttttgcattcttttctgtaatgcaggt |
23390841 |
T |
 |
| Q |
153 |
attaatcaagcataaagtgcttctcatcccttttattagtatatatgaaagaagaatagaagtttggtatgtcaaaatcagtgtcaacttcattagcta |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23390840 |
attaatcaagcataaagtgcttctcatcccttctattagtatatatgaaagaagaatagaagtttggtatgtcaaaatcagtgtcaacttcattagcta |
23390742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University