View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17523_low_39 (Length: 243)
Name: NF17523_low_39
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17523_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 23230946 - 23231158
Alignment:
| Q |
15 |
tatacgtccaagaaagatagaaatttcaaacatgaagagttgtctggtaaatcatcaatgttgggaagggggtgggtgtccttggggcatgccttgttga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23230946 |
tatacgtccaagaaagatagaaatttcaaacatgaagagttgtctagtaaatcatcaatgttaggaagggggtaggtgtccttggggcatgccttgttga |
23231045 |
T |
|
| Q |
115 |
ccaacactacgttctataaccaatttgtatatttggcttcggttattaagtcagcctttaagaggttgagactgctttcttgttgcttctaccttttctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
23231046 |
ccaacactacgttctataaccaatttgtatatttggcttcggttattaagtcagcctttaagaggttgagactgctttatggttgcttctaccttttctg |
23231145 |
T |
|
| Q |
215 |
gggaatgcttcat |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23231146 |
gggaatgcttcat |
23231158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University