View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17523_low_40 (Length: 243)
Name: NF17523_low_40
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17523_low_40 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 9539043 - 9539286
Alignment:
| Q |
1 |
aaatttttcagtgatatatcaatgttgttggaacattgttcaattatttaaattatgaactaagttcaaatatgattttttaaatatactannnnnnnn- |
99 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9539043 |
aaatttttcaatgatatatcaattttgttggaacattgttgaattatttaaattatgaactaagttcaaatatgattttttaaatatactattttttttt |
9539142 |
T |
|
| Q |
100 |
aactcatgcataagattagaaactcacatttagatttccttgtgttannnnnnncatttcaagtgtcattttcttagatcatgccttgtcaaaaagaggt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9539143 |
aactcatgcataagattagaaactcacatttagatttccttgtgttatttttttcatttcaagtgtcattttcttagatcatgccttgtcaaaaagaggt |
9539242 |
T |
|
| Q |
200 |
tagagactcatattctaccactttcggatggaacaaagacgttt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9539243 |
tagagactcatattctaccactttcggatggaacaaagaagttt |
9539286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University