View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17523_low_42 (Length: 234)

Name: NF17523_low_42
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17523_low_42
NF17523_low_42
[»] chr3 (1 HSPs)
chr3 (17-217)||(47581717-47581915)


Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 47581915 - 47581717
Alignment:
17 gtgagtgtgaaatccaaaatgaaagcaaccaaggcagccaccatcgtgtgtgaagcgaatatgacagtcacaatatcattgaactgaaaatgcattgaaa 116  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47581915 gtgagtgtgaaatccaaaatgaaagcaaccaaggcagccaccattgtgtgtgaagcgaatatgacagtcacaatatcattgaactgaaaatgcattgaaa 47581816  T
117 tattacggaaatcaatcataaaaatagatagtgnnnnnnnnatatatttatcacgaagttttcaacaattggtttagtttcagataatctcacccatcta 216  Q
    |||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47581815 tattacggaaatcaatcataaaaatagatagtgttttttt--tatatttatcacgaagttttcaacaattggtttagtttcagataatctcacccatcta 47581718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University