View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17523_low_47 (Length: 211)
Name: NF17523_low_47
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17523_low_47 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 7127912 - 7127702
Alignment:
| Q |
1 |
acactccttcccattccttcatacatatgcttctttataaaaagtcttttattgacatccatgctataaaaggattggaaattgactaagaaaacttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7127912 |
acactccttcccattccttcatacatatacttctgtataaaaagtcttttattgacatccatgctataaaaggattggaaattgactaagaaaacttccc |
7127813 |
T |
|
| Q |
101 |
acataagttgaaataaacttctgcaggtcaccnnnnnnnnnnnnnnnntatctcatttagcttatgcataaaaacctataaacaaataagatcatgtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7127812 |
acataagttgaaataaacttctgcaggtcaccttttattaaaaaaaaaaatctcatttagcttatgcataaaaacctataaacaaataagatcatgtttt |
7127713 |
T |
|
| Q |
201 |
cgtgattattt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
7127712 |
cgtgattattt |
7127702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University