View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17524_high_4 (Length: 247)

Name: NF17524_high_4
Description: NF17524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17524_high_4
NF17524_high_4
[»] chr7 (1 HSPs)
chr7 (97-229)||(34770912-34771044)
[»] chr2 (1 HSPs)
chr2 (105-151)||(8780692-8780738)


Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 97 - 229
Target Start/End: Complemental strand, 34771044 - 34770912
Alignment:
97 ctaccaagtaatgatggggaagccaatgatcaacttcttaaatacataagttgttgcagtcgcatgtaacgaaggggccacaaccgtaacaattatgtaa 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||    
34771044 ctaccaagtaatgatggggaagccaatgatcaacttcttaaatacataagttgttgcagtcgcctgtaacgaagggtccacaaccgtaacaattatgtaa 34770945  T
197 attcatattttatgggttttcttttggcacttg 229  Q
    |||||||||||||||| ||||||||||||||||    
34770944 attcatattttatgggctttcttttggcacttg 34770912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 151
Target Start/End: Original strand, 8780692 - 8780738
Alignment:
105 taatgatggggaagccaatgatcaacttcttaaatacataagttgtt 151  Q
    |||||||| |||| ||||||||||||||||||| || ||||||||||    
8780692 taatgatgaggaaaccaatgatcaacttcttaattatataagttgtt 8780738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University