View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17524_high_5 (Length: 247)
Name: NF17524_high_5
Description: NF17524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17524_high_5 |
 | |
|
| [»] chr3 (9 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 10 - 247
Target Start/End: Original strand, 9613452 - 9613689
Alignment:
| Q |
10 |
atgaatcagcaaaacaactacaagaaaccttaattgaacgtgctgacgtgcttgacttcaacaaactctccgtccttcatttaggaacccgttacatctc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9613452 |
atgaatcagcaaaacaactacaagaaaccttaattgaacgtgctgacgtgcttgacttcaacaaactctccgtccttcatttaggaacccgttacatctc |
9613551 |
T |
|
| Q |
110 |
caaccaatacggagtgtgccctgaaaccgcccttgctgtcacgtgccatgggaaaaaccctctcttactcggcacattgagtcatttttcccatctgcca |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9613552 |
caaccaatacggaaagtgccctgaaaccgcccttgctgtcacgtgccatgggaaaaaccctctcttactcggcacattgagtcatttttcccatctgcca |
9613651 |
T |
|
| Q |
210 |
gtgatttttcgtggctgcaacgagcagtggaagctgtt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9613652 |
gtgatttttcgtggctgcaacgagcagtggaagctgtt |
9613689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 9370210 - 9370168
Alignment:
| Q |
55 |
acgtgcttgacttcaacaaactctccgtccttcatttaggaac |
97 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
9370210 |
acgtgcttgacttcaacaaactctccatcctttatttaggaac |
9370168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 9341155 - 9341107
Alignment:
| Q |
140 |
ccttgctgtcacgtgccatgggaaaaaccctctcttactcggcacattg |
188 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
9341155 |
ccttgctgtcacgtgccatgggaaggaccctctcatactcggctcattg |
9341107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 97
Target Start/End: Original strand, 9441354 - 9441394
Alignment:
| Q |
57 |
gtgcttgacttcaacaaactctccgtccttcatttaggaac |
97 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9441354 |
gtgcttgacttcaacaaactctccgtcctcaatttaggaac |
9441394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 141 - 200
Target Start/End: Complemental strand, 9377536 - 9377477
Alignment:
| Q |
141 |
cttgctgtcacgtgccatgggaaaaaccctctcttactcggcacattgagtcatttttcc |
200 |
Q |
| |
|
||||||||||| |||||||||||||| |||||| | || |||||||||||| ||| |||| |
|
|
| T |
9377536 |
cttgctgtcacatgccatgggaaaaagcctctcgtgcttggcacattgagttattgttcc |
9377477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 194
Target Start/End: Complemental strand, 9348471 - 9348417
Alignment:
| Q |
140 |
ccttgctgtcacgtgccatgggaaaaaccctctcttactcggcacattgagtcat |
194 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| |||||||| | ||| |||||| |
|
|
| T |
9348471 |
ccttgcggtcatgtgccatgggaaaaaccctcttttactcggaagattaagtcat |
9348417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 98
Target Start/End: Complemental strand, 9341264 - 9341227
Alignment:
| Q |
61 |
ttgacttcaacaaactctccgtccttcatttaggaacc |
98 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
9341264 |
ttgacttcaacaaactctccgttcttcacttaggaacc |
9341227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 200
Target Start/End: Complemental strand, 9370128 - 9370068
Alignment:
| Q |
140 |
ccttgctgtcacgtgccatgggaaaaaccctctcttactcggcacattgagtcatttttcc |
200 |
Q |
| |
|
|||||| |||| |||||| |||||||||||||| |||||| ||| ||| ||||||| |||| |
|
|
| T |
9370128 |
ccttgccgtcatgtgccacgggaaaaaccctcttttactctgcagattaagtcattgttcc |
9370068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 97
Target Start/End: Original strand, 9626078 - 9626114
Alignment:
| Q |
61 |
ttgacttcaacaaactctccgtccttcatttaggaac |
97 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
9626078 |
ttgatttcaacaaactctccgtcctacatttaggaac |
9626114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 89
Target Start/End: Original strand, 449677 - 449709
Alignment:
| Q |
57 |
gtgcttgacttcaacaaactctccgtccttcat |
89 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
449677 |
gtgcttgacttcaacaaactctccgtacttcat |
449709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University