View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17524_low_2 (Length: 402)
Name: NF17524_low_2
Description: NF17524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17524_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 261 - 384
Target Start/End: Complemental strand, 28654955 - 28654829
Alignment:
| Q |
261 |
tccagcttataagtctcagtgtccgagaggcaacttctaacaagtgtatatgatga---catagacataccattgcaatggcgtctctagcagaaagagc |
357 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28654955 |
tccagcttataagtctcaccgtccgagaggcaactcctaacatgtgtatatgatgatgacatagacataccattgcaataccgtctctagcagaaagagc |
28654856 |
T |
 |
| Q |
358 |
gacaatatcagcacatgacactgtcaa |
384 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28654855 |
aacaatatcagcacatgacactgtcaa |
28654829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 304 - 384
Target Start/End: Complemental strand, 28635628 - 28635548
Alignment:
| Q |
304 |
gtgtatatgatgacatagacataccattgcaatggcgtctctagcagaaagagcgacaatatcagcacatgacactgtcaa |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||| |||||||||||||| |
|
|
| T |
28635628 |
gtgtatatgatgacatagacataccattgcaataccgtctctagcagatagagcgacaatgtcagcgcatgacactgtcaa |
28635548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 28655083 - 28655027
Alignment:
| Q |
123 |
aaaacatgatatgcttctcgcgttatttaattatatattactattttacatgcattc |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28655083 |
aaaacatgatatgcttctcccgttatttaattatatattactattttacatgcattc |
28655027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 13 - 75
Target Start/End: Complemental strand, 28655197 - 28655135
Alignment:
| Q |
13 |
tgaagacatattagccttaaatacatgataaattaggtcaaaaccaaggccatctcattctgg |
75 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
28655197 |
tgaagacatacgagccttaaatacatgataaattaggtcaaaaccaaggccctctcatgctgg |
28655135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 322 - 384
Target Start/End: Complemental strand, 28605442 - 28605380
Alignment:
| Q |
322 |
acataccattgcaatggcgtctctagcagaaagagcgacaatatcagcacatgacactgtcaa |
384 |
Q |
| |
|
||||||| | ||||| ||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
28605442 |
acataccctggcaataccgtctctagcagaaagagcaacaatgtcagcgcatgacactgtcaa |
28605380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 212 - 256
Target Start/End: Complemental strand, 50880618 - 50880574
Alignment:
| Q |
212 |
ttttaggcccagctcggctgagctatttgcactccctcagggacg |
256 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
50880618 |
ttttaggcccagctcgtttgagctgtttgcaccccctcagggacg |
50880574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 253
Target Start/End: Complemental strand, 54779487 - 54779450
Alignment:
| Q |
216 |
aggcccagctcggctgagctatttgcactccctcaggg |
253 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
54779487 |
aggcccagctcggttgagctgtttgcactccctcaggg |
54779450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University