View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17526_low_3 (Length: 434)
Name: NF17526_low_3
Description: NF17526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17526_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 176 - 418
Target Start/End: Complemental strand, 8847573 - 8847332
Alignment:
| Q |
176 |
cttaactaaacggcctccaatgtatgattgtgtgaatgctttgatttgatggcagcagcaaatccaggtttgtaagtgattatccttcttcgctttacaa |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8847573 |
cttaactaaacggcctccaatgtatgattgtgtgaatgctttgatttgatggcagcagcaaatccaggtttgtaagtgattatccttcttcgctttacaa |
8847474 |
T |
 |
| Q |
276 |
acaacaagaatttatgatcagattctcaactaaactcaacgaacaattcttgttattcttcacttttcatttttgaaatactataaaataaacaaaattt |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8847473 |
acaacaagaatttatgatcagattctcaactaaactcaacgaacaattcttgttattc-tcacttttcatttttgaaatactataaaataaacaaaattt |
8847375 |
T |
 |
| Q |
376 |
tgaaactcatgttccacgagtacatgaaatatatcaatcaagc |
418 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8847374 |
tgaaactcatgttccacgagtatatgaaatatatcaatcaagc |
8847332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 18 - 125
Target Start/End: Complemental strand, 8847731 - 8847624
Alignment:
| Q |
18 |
ataccaatgtgtgtacgtgaccaaattggagcttactatatcaattatttcttgcttttaattcgtatgtaaccattcaatcttgatcgaacaatctaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| | |||| ||||||||||||||||||||| |
|
|
| T |
8847731 |
ataccaatgtgtgtacgtgaccaaattggagcttactatatcaattatttcttgctgttaattcttatgtagctattccatcttgatcgaacaatctaaa |
8847632 |
T |
 |
| Q |
118 |
atgtatcg |
125 |
Q |
| |
|
|||||||| |
|
|
| T |
8847631 |
atgtatcg |
8847624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University