View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17526_low_7 (Length: 255)
Name: NF17526_low_7
Description: NF17526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17526_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 6996434 - 6996680
Alignment:
| Q |
1 |
ttcacgcaactcttcgcctcttctcctcaccggctgccggagaccgagacccgcgacggtggtcacacgtgctggcgcaagtacaagtagctatgctttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6996434 |
ttcacgcaactcttcgcctcttctcctcaccggctgccggagaccgagacccgcgacggtggtcacacgtgctggcgcaagtacaagtagctatgccttc |
6996533 |
T |
|
| Q |
101 |
gcgattgctcttcctctttctctcctcggtataactgttttcactgctcttcggattggtcagaagcttgaccaagatttctacgaagaggtaatgccac |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6996534 |
gcgattgcgcttcctctttctctcctcggtataactgttttcactgctcttcggattggtcagaagcttgaccaagatttctatgaagaggtaatgccac |
6996633 |
T |
|
| Q |
201 |
aaactaatgttgggtttttctcagtaatgtgattctttgtctgtgct |
247 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
6996634 |
aaactaatgttgagtttttctcagtaatgtgattctttgtttgtgct |
6996680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University