View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17527_high_1 (Length: 239)
Name: NF17527_high_1
Description: NF17527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17527_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 110 - 228
Target Start/End: Complemental strand, 768701 - 768583
Alignment:
| Q |
110 |
gcaaattagaacatatgcaagccaatagtgacataggattagatacttgataggtatattcatcaaaaaacatatactttatgtgtccaatgatttgttt |
209 |
Q |
| |
|
||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
768701 |
gcaaattagaatatatgcacgccaatagagacataggattagatacttgataggtatattcaccaaaaaacatacacttgatgtgtccaatgatttgttt |
768602 |
T |
|
| Q |
210 |
ttctttttggtaacaaatg |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
768601 |
ttctttttggtaacaaatg |
768583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 17 - 102
Target Start/End: Complemental strand, 768827 - 768742
Alignment:
| Q |
17 |
aactaattgactaaatttgaattaccctcaacacttcaagaatcaatccataaaactaacgagaacatatatacgacccaatccat |
102 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
768827 |
aactaattgactaaatttgaattgccctcaacacttcaagaatcaatccataaaactaacgagaacatatatacgacccaatccat |
768742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University