View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17527_high_2 (Length: 227)
Name: NF17527_high_2
Description: NF17527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17527_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 18786939 - 18787121
Alignment:
| Q |
33 |
taaccaccgaaatcaaagtcaacacctaaatcaaaaccaaacccccaaataatcgtcgaaatcaaacttgagcgaaaatcacaaacgacattgtgaatgg |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
18786939 |
taaccaccgaaatcaaagtcaacacctaaatcaaaaccaaacccctaaataatcgtcgaaaccaaacttcagcgaaaatcacaaaggatattgtgaatgg |
18787038 |
T |
 |
| Q |
133 |
ccacatgcacaaattctaaaccgttgtcacccgctactcacaaaaatttctatnnnnnnnccatcaaactaatcaaaaccctg |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||| ||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
18787039 |
ccacatgcacaaattccaaaccgttgtcatccggtactcacaaaaatttctataaaaaaaccatcaaaccaatcaaaaccctg |
18787121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University