View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17528_high_7 (Length: 241)
Name: NF17528_high_7
Description: NF17528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17528_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 168076 - 168321
Alignment:
| Q |
1 |
aatattgactaaaacaaatcgcaattatgcagatttgtcctaaagcatcatatcataatcacacccatgcataaagctacgcacaacagtgcatgcaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
168076 |
aatattgactaaaacaaatcgcaattatgcagatttgtcctaaagcatcatatcataatcacacccatgcataaaggtacgcacaacagtgcatgcaatt |
168175 |
T |
 |
| Q |
101 |
caactactctttaaatggaaaagctaattgcctgtcctttttcttctgtt---------------ccaagttagggttaagggcgtccatgtgacctaaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
168176 |
caactactctttaaatggaaaagctaattgcctgtcctttttcttctgttccttctctttaaatgccaagttagggttaagggcgtccatgtgacctaaa |
168275 |
T |
 |
| Q |
186 |
ttgtatgaatgtggtgaactaaaattgtttcgttaaggtttctgtg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
168276 |
ttgtatgaatgtggtgaactaaaattgtttcgttaaggtttctgtg |
168321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University