View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1752_high_10 (Length: 247)
Name: NF1752_high_10
Description: NF1752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1752_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 45270361 - 45270145
Alignment:
| Q |
15 |
tgaacaataaatttgagcgtaaaatacactcttggattcaaaagatacaaatacttgcttaagttacaaccaattctgagacaaagtcaatttcaatcaa |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45270361 |
tgaacaataaatttgagcgtaaaattcactcttggattcaaaagatacaaattcttgcttaagttacaaccaattctgagacaaagtcaatttcaatcaa |
45270262 |
T |
 |
| Q |
115 |
cgtcattgagctgaacgtgaaattgtttatgtgtagatacattcgcctaaaaatgagttgaataataaagttgagtgcatagatcatctttggattgaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45270261 |
cgtcattgagctgaacgtgaaattgtttatgtgtagatacattcgcctaaaaatgagttgaataataaagttgagtgcatagatcatctttggattcaaa |
45270162 |
T |
 |
| Q |
215 |
taatgtcagtcattttc |
231 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
45270161 |
ttatgtcagtcattttc |
45270145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University