View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1752_high_13 (Length: 230)
Name: NF1752_high_13
Description: NF1752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1752_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 9 - 228
Target Start/End: Complemental strand, 44461341 - 44461122
Alignment:
| Q |
9 |
gttgtcacttatttttcttgttcttctcggagttgggtttttattgattgttgtgtgcaaccacgaggatatggtagaggaaggtttcatggttttataa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44461341 |
gttgtcacttatttttcttgttcttctcggagttgggtttttattgattgttgtgtgcaaccacgaggatatggtagaggaaggtttcatggttttataa |
44461242 |
T |
|
| Q |
109 |
tggggggagagaggtacatttggtgtccagtgatttgttttttgctataataggaatttgtttgttattcaatacacttaatttggaggaagatctttac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44461241 |
tggggggagagaggtacatttggtgtccagtgatttgttttttgctataataggaatttgtttgttattcaatacacttaatttggaggaagatctttac |
44461142 |
T |
|
| Q |
209 |
caaaaaatgaaccctgcatc |
228 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
44461141 |
caaaaaatgaacccttcatc |
44461122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University