View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1752_high_14 (Length: 227)
Name: NF1752_high_14
Description: NF1752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1752_high_14 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 7 - 93
Target Start/End: Complemental strand, 81035 - 80949
Alignment:
| Q |
7 |
cacagaaccacctagaggctgtcctagcacaccctaacacatgtctaacaaaactgaaagcacacaggggcgagaccagcagcacag |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||| |
|
|
| T |
81035 |
cacagaaccacctagaggctgtcctagcacaccctaacacatgtctaacaaaaccgaaagcacacaggggagagaccagcagtacag |
80949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 7 - 110
Target Start/End: Original strand, 4354485 - 4354586
Alignment:
| Q |
7 |
cacagaaccacctagaggctgtcctagcacaccctaacacatgtctaacaaaactgaaagcacacaggggcgagaccagcagcacagcaaaggcagaaaa |
106 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| | | ||||||||||||||||||||| ||||||||||||||||||| || |||||||||| |
|
|
| T |
4354485 |
cacagaaccacgtagtggctgtcctagcacaccctaacataaggctaacaaaactgaaagcacac--gggcgagaccagcagcacatcagaggcagaaaa |
4354582 |
T |
 |
| Q |
107 |
cagc |
110 |
Q |
| |
|
|||| |
|
|
| T |
4354583 |
cagc |
4354586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 130 - 227
Target Start/End: Complemental strand, 29265538 - 29265443
Alignment:
| Q |
130 |
gaggttctaagtttattactcaatatgtgtgtttaaggttgttgagatatgcactgatttggtcttcactattaggatagtcttataaattaacggca |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| | |||||||||||| ||| ||||||| |||| |
|
|
| T |
29265538 |
gaggttctaagtttattactcatc--gtgtgtttaaggttgttgagacatgcactgatttggtctttaatattaggatagttttaaaaattaatggca |
29265443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 130 - 227
Target Start/End: Original strand, 443514 - 443609
Alignment:
| Q |
130 |
gaggttctaagtttattactcaatatgtgtgtttaaggttgttgagatatgcactgatttggtcttcactattaggatagtcttataaattaacggca |
227 |
Q |
| |
|
||||||||||||||||| ||||||||| || ||||||||||||||||||| ||||||||| ||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
443514 |
gaggttctaagtttattgctcaatatgcgt--ttaaggttgttgagatatgtactgatttgatcttcgctatccggatagtcttaaaaattaacggca |
443609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University