View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17532_high_15 (Length: 326)
Name: NF17532_high_15
Description: NF17532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17532_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 9 - 153
Target Start/End: Complemental strand, 10188429 - 10188286
Alignment:
| Q |
9 |
gagatgaaaaccaatttcttaggtgttagagttagaagtggcactttttgttgatggttatgactttttctaaaattagcttcatttagtcattgtcacc |
108 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10188429 |
gagatgaaaactaatttcttaggtgt-agagttagaagtggcactttttgttgatggttatgactttttctaaaattagcttcatttagtcattgtcacc |
10188331 |
T |
|
| Q |
109 |
ttaatttgtgggatgaataatttttcaagaaaaatatttcaatac |
153 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10188330 |
ttaatttgtgtgatgaataatttttcaagaaaaatatttcaatac |
10188286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 220 - 309
Target Start/End: Complemental strand, 10188221 - 10188132
Alignment:
| Q |
220 |
tctctctctgtgcacggcctaaaagtatcaattttttgtaaaatatgaaggcaaataatttggtaannnnnnnagagactaaactcaaat |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10188221 |
tctctctctgtgcacggcctaaaagtatcaattttttgtaaaatatgaaggcaaataatttggtaatttttttagagactaaactcaaat |
10188132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University