View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17532_high_24 (Length: 228)
Name: NF17532_high_24
Description: NF17532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17532_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 6406545 - 6406333
Alignment:
| Q |
1 |
attcctcattgtgcagagtggaagaaatcatgtttttcaactcttccattatgatgagatctggtga--gagttgattatcataatgtatcagtcatgaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6406545 |
attcctcattgtgcagagtggaagaaatcatgtttttctactcttccattatgatgtgatctggtgatagagttgattatcataatgtatcagtcatgaa |
6406446 |
T |
 |
| Q |
99 |
tcatgataagatattattttgattgagcaacaatatatgctgtgctaaaattggaatagtggcagttacctatagtagaaaatttaattataagtcatca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6406445 |
tcatgataagatattattttgattgagcaacaatatatgctgtgctaaaattggaatagtggtagttacctatagtagaaaatttaattataagtcatca |
6406346 |
T |
 |
| Q |
199 |
ttagcatgaagaa |
211 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6406345 |
ttagcatgaagaa |
6406333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University