View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17532_high_25 (Length: 210)
Name: NF17532_high_25
Description: NF17532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17532_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 75 - 176
Target Start/End: Original strand, 41261756 - 41261857
Alignment:
| Q |
75 |
gtacgagtaattcaatcaaggaaaattcaaaccactcttggctcctttgatgcacatgatgaatgaaagatacggtgattgtattatactttgtctcaat |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41261756 |
gtacgagtaattcaatcaaggaaaattcaaaccactcttggctcctttgatgcacatgatgaatgaaagatacggtgattgtattatactttgtctcaat |
41261855 |
T |
 |
| Q |
175 |
gt |
176 |
Q |
| |
|
|| |
|
|
| T |
41261856 |
gt |
41261857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 54
Target Start/End: Original strand, 41261717 - 41261755
Alignment:
| Q |
16 |
aagaaaacaaaaacaaaagcgtatcaaattttggcttat |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41261717 |
aagaaaacaaaaacaaaagcgtatcaaattttggcttat |
41261755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University