View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17532_high_9 (Length: 447)
Name: NF17532_high_9
Description: NF17532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17532_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 282 - 398
Target Start/End: Original strand, 12174810 - 12174928
Alignment:
| Q |
282 |
gaagcataaagaataaccttgaaccaagacataaactcnnnnnnnt--tgtttaaattaataataatgttgatttttatgtttgttttttattgaacacg |
379 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12174810 |
gaagcataaagaataaccttcaaccaagacataaactcaaaaagaaaatgtttaaattaataataatattgatttttatgtttgttttttattgaacacg |
12174909 |
T |
 |
| Q |
380 |
tagaaaattggttttcaaa |
398 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12174910 |
tagaaaattggttttcaaa |
12174928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University