View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17532_low_10 (Length: 447)

Name: NF17532_low_10
Description: NF17532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17532_low_10
NF17532_low_10
[»] chr6 (1 HSPs)
chr6 (282-398)||(12174810-12174928)


Alignment Details
Target: chr6 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 282 - 398
Target Start/End: Original strand, 12174810 - 12174928
Alignment:
282 gaagcataaagaataaccttgaaccaagacataaactcnnnnnnnt--tgtttaaattaataataatgttgatttttatgtttgttttttattgaacacg 379  Q
    |||||||||||||||||||| |||||||||||||||||          ||||||||||||||||||| ||||||||||||||||||||||||||||||||    
12174810 gaagcataaagaataaccttcaaccaagacataaactcaaaaagaaaatgtttaaattaataataatattgatttttatgtttgttttttattgaacacg 12174909  T
380 tagaaaattggttttcaaa 398  Q
    |||||||||||||||||||    
12174910 tagaaaattggttttcaaa 12174928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University