View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17532_low_22 (Length: 261)
Name: NF17532_low_22
Description: NF17532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17532_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 57 - 242
Target Start/End: Complemental strand, 31442826 - 31442641
Alignment:
| Q |
57 |
ctcaacttatttatgatatgaaactgtctataattaatgtaattttaattttaagattattataacaagatgaagagaaattgaatatttttaaaccctt |
156 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
31442826 |
ctcaacttatttatgatatgaaattgtctatgattaacgtaattttaattttaagattattataacaagatgaaaacaaattgaatatttttaagccctt |
31442727 |
T |
 |
| Q |
157 |
caaagctcccatctagtattatttttgagttactctacattaacgtaatttaatagtacaaagaagaagaaaaataagttcctcat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31442726 |
caaagctcccatctagtattatttttgagttactctacattaacgtaatttaatagtacaaagaagaagaaaaataagttcctcat |
31442641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 31443206 - 31443165
Alignment:
| Q |
1 |
aaagctttggaggagatcaaggagacgagagataaagggccc |
42 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
31443206 |
aaagctttggaggagatcaaagagatgagagataaagggccc |
31443165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University