View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17532_low_23 (Length: 245)
Name: NF17532_low_23
Description: NF17532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17532_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 27202245 - 27202036
Alignment:
| Q |
1 |
aagaaacaactccaggacaagcagtttccaattgagttttaatgttgtcaatcacatcaaaacctctcagagaattcacatttgcgccagccgacttctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27202245 |
aagaaacaactccaggacaagcagtttccaattgagttttaatgttgtcaatcacataaaaacctctcagagaattcacatttgcgccagccgacttctc |
27202146 |
T |
|
| Q |
101 |
tccggtgaagcttgaagtgtcgtctaataggactgatgcatcacatccctgcaagttataaaatcatcattgaagatacaaatttctctacaactgcagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27202145 |
tccggtgaagcttgaagtgtcgtctaacaggactgatgcatcacatccctgcaagttataaaatcatcattgaagatgcaaatttctctacaactgcagc |
27202046 |
T |
|
| Q |
201 |
cacataattt |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
27202045 |
cacataattt |
27202036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 150
Target Start/End: Complemental strand, 26960976 - 26960872
Alignment:
| Q |
46 |
tgtcaatcacatcaaaacctctcagagaattcacatttgcgccagccgacttctctccggtgaagcttgaagtgtcgtctaataggactgatgcatcaca |
145 |
Q |
| |
|
||||||| |||||||||||||| | ||||| ||||||| || || | || || || ||||| ||||| || |||||||| || |||||||||||||| |
|
|
| T |
26960976 |
tgtcaattacatcaaaacctcttaaggaattagcatttgcacctgctgttttttcaccagtgaaacttgatgtatcgtctaacagtactgatgcatcaca |
26960877 |
T |
|
| Q |
146 |
tccct |
150 |
Q |
| |
|
||||| |
|
|
| T |
26960876 |
tccct |
26960872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University