View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17532_low_24 (Length: 238)
Name: NF17532_low_24
Description: NF17532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17532_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 12 - 221
Target Start/End: Complemental strand, 9905612 - 9905404
Alignment:
| Q |
12 |
caaaggtttggggttcatatataaacaagtaagtaatcaaggaaatccgacataaacaataaatatatatatttttaaaacaaccggtaacaatgacgtt |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9905612 |
caaaggtttagggttcatatataaacaagtaagtaatcaaggaaatccgacataaacaataaatatatat--ttttaaaacaaccggtaacaatgacgtt |
9905515 |
T |
 |
| Q |
112 |
tgttgcaaaaggaaacaaattcatcaaacattagtaatactttggaa-ttccaacctttatagagtgtttatgtcctacgtacatatccatggaccatga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| || || | ||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
9905514 |
tgttgcaaaaggaaacaaattcatcaaacactagtaatactttgaaatttttagcctttatagagtgtttatgtcgtacgtacatatccatggatcatga |
9905415 |
T |
 |
| Q |
211 |
ttgtccattaa |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
9905414 |
ttgtccattaa |
9905404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University