View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17533_high_21 (Length: 221)
Name: NF17533_high_21
Description: NF17533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17533_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 42 - 220
Target Start/End: Original strand, 38129893 - 38130071
Alignment:
| Q |
42 |
ggttatgatttgttttagatgataattttcaaacaagcttacagtaaaaagatcactaatacgtacatgggtatttcatgcctgtaatttaattgaagcc |
141 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38129893 |
ggttatgatttgttttagataataattttcaaacaagcatacagtaaaaagatcactaatacgtacatgggtatttcatgcctgtaatttaattgaagcc |
38129992 |
T |
|
| Q |
142 |
ctataggaaattgaacttgaggagctacttgagctgcaggaacaagaggtatttgaggtactggatggaacacattagt |
220 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38129993 |
ctagaggaaattgaacttgaggagctacttgagctgcaggaacaagaggtatttgaggtactggatggaacacattagt |
38130071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University