View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17533_low_21 (Length: 221)

Name: NF17533_low_21
Description: NF17533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17533_low_21
NF17533_low_21
[»] chr1 (1 HSPs)
chr1 (42-220)||(38129893-38130071)


Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 42 - 220
Target Start/End: Original strand, 38129893 - 38130071
Alignment:
42 ggttatgatttgttttagatgataattttcaaacaagcttacagtaaaaagatcactaatacgtacatgggtatttcatgcctgtaatttaattgaagcc 141  Q
    |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38129893 ggttatgatttgttttagataataattttcaaacaagcatacagtaaaaagatcactaatacgtacatgggtatttcatgcctgtaatttaattgaagcc 38129992  T
142 ctataggaaattgaacttgaggagctacttgagctgcaggaacaagaggtatttgaggtactggatggaacacattagt 220  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38129993 ctagaggaaattgaacttgaggagctacttgagctgcaggaacaagaggtatttgaggtactggatggaacacattagt 38130071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University