View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17535_high_17 (Length: 323)
Name: NF17535_high_17
Description: NF17535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17535_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 16 - 306
Target Start/End: Complemental strand, 36942529 - 36942239
Alignment:
| Q |
16 |
atcatgtaatacaaacactattatgagccgtttcgagtcaccagcttctgctttttatgcaacagaaaactgcatgggatttgcagagtttgatcaccaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36942529 |
atcatgtaatacaaacactattatgagccgtttcgagtcaccagcttctgctttttatgcaacagaaaactgcatgggatttgcagaatttgatcaccaa |
36942430 |
T |
|
| Q |
116 |
gttgataataatcaatctttgagttctcaatcatataaggttaatgatttggaattccctttgtgtcaatctcttagggaaaacaatcatttattggatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942429 |
gttgataataatcaatctttgagttctcaatcatataaggttaatgatttggaattccctttgtgtcaatctcttagggaaaacaatcatttattggatg |
36942330 |
T |
|
| Q |
216 |
catcaaaccaacatgaccccaactttgaactgtctaacactttgcaagcattggtgaaatctcaattgaatggtaatcaacaccttagatt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942329 |
catcaaaccaacatgaccccaactttgaactgtctaacactttgcaagcattggtgaaatctcaattgaatggtaatcaacaccttagatt |
36942239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 119
Target Start/End: Complemental strand, 22815056 - 22814972
Alignment:
| Q |
35 |
attatgagccgtttcgagtcaccagcttctgctttttatgcaacagaaaactgcatgggatttgcagagtttgatcaccaagttg |
119 |
Q |
| |
|
|||||||| |||| ||||||||| |||| ||||||||||||||||||| |||||||| ||| || | | |||| ||||||||| |
|
|
| T |
22815056 |
attatgagaagttttgagtcaccaacttcagctttttatgcaacagaaatttgcatgggttttccacaatatgattaccaagttg |
22814972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University