View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17535_high_28 (Length: 269)
Name: NF17535_high_28
Description: NF17535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17535_high_28 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 34037260 - 34037528
Alignment:
| Q |
1 |
ttggctgggaaaatacccattactcctgaggtgaagtgggagaactaattggtttgcctcgtccgatggcgaaacctcttgttccatctggcattctagg |
100 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34037260 |
ttggctggtacaatacccattactcctgaggtgaagtgggagaactaatcggtttgcctcgtccgatggcgaaacctcttgttccatctggcattctagg |
34037359 |
T |
|
| Q |
101 |
gccctttgcattgggtttagttgacacttcacccaggacaacactgcttgatggagatggtggggcaagtaggccacgtccggtatggttttgagtgcgt |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34037360 |
gccctttgcattgggtttagtcgacacttcacccaggacaacactgcttgatggagatggtggggcaagtaggccacgtccggtatggttttgagtgcgt |
34037459 |
T |
|
| Q |
201 |
cctcttccctttcctcgacctctagtccatcctttctttgatccgactgaagtttcatcacccttccaa |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34037460 |
cctcttccctttcctcgacctctagtccatcctttctttgatccgactgaagtttcatcacccttccaa |
34037528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University