View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17535_high_33 (Length: 239)
Name: NF17535_high_33
Description: NF17535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17535_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 223
Target Start/End: Original strand, 9197917 - 9198130
Alignment:
| Q |
10 |
ataattctgaggagctagttggtgcagctgcacttgcatttggtcatgcatctcttgcaatcatagagtgtaggatagcaactgtagcaattacatttgt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9197917 |
ataattctgaggagctagttggtgcagctgcacttgcatttggtcatgcatctcttgcaatcatagagtgtaggatagcaactgtagcaattacatttgt |
9198016 |
T |
 |
| Q |
110 |
tgatgcaatttgttttgaaaccaccatcccataagcaacgagccatgcagtgaaggactggatagcaggttggacaactctttttcatctggtttacaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9198017 |
tgatgcaatttgttttgaaaccaccatcccataagcaacgagccatgcagtgaaggactggatagcaggttggacaactctttttcatctggtttacaat |
9198116 |
T |
 |
| Q |
210 |
gcagtctttgcacc |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9198117 |
gcagtctttgcacc |
9198130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University