View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17535_high_35 (Length: 237)
Name: NF17535_high_35
Description: NF17535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17535_high_35 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 34375283 - 34375503
Alignment:
| Q |
17 |
gacagttggaacagaagtgtcccaatgaccagagataacaagaatggcagatggtctctcaggaaacacctctttccatgatgtcaagaatttccatgca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34375283 |
gacagttggaacagaagtgtcccaatgaccagagataacaagaatggcagatggtctctcaggaaacacctctttccatgatgtcaagaatttccatgca |
34375382 |
T |
|
| Q |
117 |
ggaattgtttcatctatggctagtgttggtgatccatgtgatatgtagaacgtttccttcaatgccattttttgtatatttttgcttattgaattcacta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34375383 |
ggaattgtttcatctatggctagtgttggtgatccatgtgatatgtagaacgtttccttcaatgccattttttgtatatttttgcttattgaattcacta |
34375482 |
T |
|
| Q |
217 |
tttctcttgtattttcgttcc |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34375483 |
tttctcttgtattttcgttcc |
34375503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 141 - 185
Target Start/End: Original strand, 24061623 - 24061667
Alignment:
| Q |
141 |
gttggtgatccatgtgatatgtagaacgtttccttcaatgccatt |
185 |
Q |
| |
|
||||||||||||||||||||||| || || ||||||||||||||| |
|
|
| T |
24061623 |
gttggtgatccatgtgatatgtaaaatgtatccttcaatgccatt |
24061667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University