View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17535_low_21 (Length: 311)
Name: NF17535_low_21
Description: NF17535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17535_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 131 - 294
Target Start/End: Complemental strand, 54947049 - 54946875
Alignment:
| Q |
131 |
agaatctaattttttatacaatttataaattataaaatgtcaaaatcgtccttttttattgctaacaaacgca-----------taatgttttgcaattt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||| |||| |
|
|
| T |
54947049 |
agaatctaattttttatacaatttataaattataaaatgtcaaaatcgtctttttttattcctaacaaacgcacgttactgtaataatgttttgtgattt |
54946950 |
T |
|
| Q |
220 |
cattggtgtcgtgcttctcttctatatgttttcatgtttaaaaagatggaatattgttggttgatgaattaatta |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
54946949 |
cattggtgtcgtgcttctcttctatatgttttcatgtttaaaaagatagaatattgttggtcgatgaattaatta |
54946875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 27 - 77
Target Start/End: Complemental strand, 54947153 - 54947103
Alignment:
| Q |
27 |
caataataaacaaactataaatcacttttatgataaaattatcacttttgt |
77 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54947153 |
caataataaacaaactataaatcactattatgataaaattatcacttttgt |
54947103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University