View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17535_low_39 (Length: 228)
Name: NF17535_low_39
Description: NF17535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17535_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 22363067 - 22362869
Alignment:
| Q |
13 |
gagatgaactagaggaaaggagaataaagacgggggatttgtatgtaattccagcaggtactgtattttatttagtgaatataggtgaaggtcagagact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22363067 |
gagatgaactagaggaaaggagaataaagacaggggatttgtatgtaattccagcaggtactgtattttatttagtgaatataggtgaaggtcagagact |
22362968 |
T |
|
| Q |
113 |
tcatgtcatatgcagttttgacccctctacaagtttaggtgatacttttcaggtacatatatgcatctataatttcacatgtttcacttacatattatc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
22362967 |
tcatgtcatatgcagttttgacccctctacaagtttaggtgatacttttcaggtacatatatgcttctataatttcacatgtttcactcacatattatc |
22362869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University