View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17535_low_40 (Length: 227)
Name: NF17535_low_40
Description: NF17535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17535_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 3391026 - 3391247
Alignment:
| Q |
1 |
tctatgcaaattgtgatggttgtgtatttacttctttcaagttctctattttatagccagatttggcactaaacattcaatttcttgttaatttatgtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3391026 |
tctatgcaaattgtgatggttgtgtatttacttctttcaagttctctattttatagccagatttggcactaaacattcaatttcttgttaatttatgtca |
3391125 |
T |
 |
| Q |
101 |
ctatctcattttgatgtgacacttaaaaattttataattagaacgttaattgataacgttatactaattaaatgctttcaacgaaat-ctagttaacata |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3391126 |
ctatctcattttgatgtgacacttaaaaattctataattagaacgttaattaataacgttatactaattaaatgctttcaacgaaatcctagttaacata |
3391225 |
T |
 |
| Q |
200 |
taaccctagaatagacttgttc |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3391226 |
taaccctagaatagacttgttc |
3391247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University