View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17535_low_6 (Length: 419)
Name: NF17535_low_6
Description: NF17535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17535_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 3e-70; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 10 - 148
Target Start/End: Complemental strand, 3174261 - 3174123
Alignment:
| Q |
10 |
gtgagatgaactattcctagtaaccctttgagttgttgtagtgacacaatgattgctgcaccagccatgaaacctaccaatgttgcctttgatagaaaat |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3174261 |
gtgaaatgaactattcctagtaaccctttgagttgttgtagtgacacaatgattgctgcaccagccatgaaacctaccaatgttgcctttgatagaaaat |
3174162 |
T |
 |
| Q |
110 |
caatcacaaagcctaacctgtatacaccttcaaaggtta |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3174161 |
caatcacaaagcctaacctgtatacaccttcaaaggtta |
3174123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 202 - 273
Target Start/End: Complemental strand, 3174027 - 3173955
Alignment:
| Q |
202 |
ttaaatttccaaagtt-catctttaatttttaaaaataaacccacttggtggggaaaaaattattgtaatttt |
273 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||| | ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3174027 |
ttaaattttcaaagtttcatttttaattttcagaaataaacccacttggtggggcaaaaattattgtaatttt |
3173955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 314 - 355
Target Start/End: Complemental strand, 3173933 - 3173892
Alignment:
| Q |
314 |
aaatattatgaaatgatttttagttgatttcaataagatttt |
355 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3173933 |
aaatattatgaaatgatttttagtttatttcaataagatttt |
3173892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 133
Target Start/End: Complemental strand, 32966275 - 32966182
Alignment:
| Q |
40 |
agttgttgtagtgacacaatgattgctgcaccagccatgaaacctaccaatgttgcctttgatagaaaatcaatcacaaagcctaacctgtata |
133 |
Q |
| |
|
||||||||||| |||||||| || || || |||||||| || || | || |||||||| |||||||||||||| | ||| |||| |||||||| |
|
|
| T |
32966275 |
agttgttgtagagacacaattatggcagctccagccataaacccaattaaggttgccttagatagaaaatcaatgataaatcctagcctgtata |
32966182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 22 - 129
Target Start/End: Original strand, 44012884 - 44012991
Alignment:
| Q |
22 |
attcctagtaaccctttgagttgttgtagtgacacaatgattgctgcaccagccatgaaacctaccaatgttgcctttgatagaaaatcaatcacaaagc |
121 |
Q |
| |
|
||||| ||||||||||| | ||| || | |||||||||||| || ||||| ||||| ||||| |||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
44012884 |
attccaagtaaccctttcaattgctgcaatgacacaatgatagcagcaccggccataaaaccgaccagggttgcttttgatagaaaatcaatcacaaagc |
44012983 |
T |
 |
| Q |
122 |
ctaacctg |
129 |
Q |
| |
|
||| |||| |
|
|
| T |
44012984 |
ctagcctg |
44012991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University