View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17536_high_6 (Length: 322)
Name: NF17536_high_6
Description: NF17536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17536_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 13715604 - 13715300
Alignment:
| Q |
1 |
agagggtgtattttggtctctgcttgttgcttctgctatatgacagctgagcacattatttttaattgctctgtcacctcacaattttggaattggctca |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715604 |
agagggtgtattttggtctctgtttgttgcttctgctatatgacagctgagcacattatttttaattgctctgtcacctcacaattttggaattggctca |
13715505 |
T |
 |
| Q |
101 |
gcaacaatataaatcaacctctcgacctatcatcttgggatattccgctgcattgctcgtagaatgtttggagccctccagtgaaacaaatcatgctttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715504 |
gcaacaatataaatcaacctctcgacctatcatcttgggatattccgctacattgctcgtagaatgtttggagccctccagtgaaacaaatcatgctttc |
13715405 |
T |
 |
| Q |
201 |
tgccaagcttcatactatttggattatttgggttgaacaaaacaaacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttatt |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715404 |
tgccaagcttcat---------attatttgggttgaacaaaacagacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttatt |
13715314 |
T |
 |
| Q |
301 |
tatgaagttcatct |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13715313 |
tatgaagttcatct |
13715300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University