View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17536_low_7 (Length: 291)
Name: NF17536_low_7
Description: NF17536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17536_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 66 - 265
Target Start/End: Original strand, 46009831 - 46010034
Alignment:
| Q |
66 |
gttggatatgttggtgaatgaaacgttaacagttatggttggcggcacgtgagtgaaaggggggtgggtccgtacgtaaaggacgtcgtcgttttggtga |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46009831 |
gttggatatgttggtgaatgaaacgttaacagttatggttggcggcacgtgagtgaaaggggggtgggtccgtacgtaaaggacgtcgtcgttttggtga |
46009930 |
T |
 |
| Q |
166 |
t----gatgatggtgatagtgggatttcaacggggagacatgaaacagaggttgtcacatggggatttagttcacgtgatgagatgctacatgttcatgt |
261 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46009931 |
tgatcgatgatggtgatagtgggatttcaacggggagacatgaaacagaggttgtcacatggggatttagttcacgtgatgagatgctacatgttcatgt |
46010030 |
T |
 |
| Q |
262 |
tcat |
265 |
Q |
| |
|
|||| |
|
|
| T |
46010031 |
tcat |
46010034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University