View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17537_high_18 (Length: 324)
Name: NF17537_high_18
Description: NF17537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17537_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 56 - 289
Target Start/End: Complemental strand, 45616122 - 45615885
Alignment:
| Q |
56 |
gtgcctactaattactcttattgtttagtctatgatttaa-tattttatttttgactgatgtcttaaccacccattttct-taatgatttcttttccaaa |
153 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||| |||||||| ||||||||| ||||||||||||||| ||| |
|
|
| T |
45616122 |
gtgcctactaattactcttaatgtttagtctatgatttaagtatcttatttttgactgatgacttaaccaaccattttctctaatgatttcttttcaaaa |
45616023 |
T |
 |
| Q |
154 |
attctatttctaaaagggcaagctggtatcctactttgaacctagctatattcttagatggaccctacttatggtttataatc--ttctattagttcaaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||| |||| |
|
|
| T |
45616022 |
attctatttctaaaagggcaagctggtatcctactttgaacctagctatattcttagatggaccctacttatggcttataatctgtgctattagtccaaa |
45615923 |
T |
 |
| Q |
252 |
ttccagagcggcataaataaagagtagccacaggttct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45615922 |
ttccagagcggcataaataaagagtagccacaggttct |
45615885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University