View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17537_high_24 (Length: 316)
Name: NF17537_high_24
Description: NF17537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17537_high_24 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 13 - 316
Target Start/End: Complemental strand, 32829094 - 32828791
Alignment:
| Q |
13 |
atactagaaatcacggtgagtgtaatgtgggtcatgatttgaaccctgattcaggggtgaggagaagctcgcgggctaggcgtgccccggttttgcttga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32829094 |
atactagaaatcacggtgagtgtaatgtgggtcatgatttgaaccctgattcaggggtgaggagaagctcgcgggctaggcgtgccccggttttgcttga |
32828995 |
T |
 |
| Q |
113 |
tgtctctcccacaccgaagaagaaacggttgaagttaggaaaggatgtagtgccgaagagtgtggagggtgataaaggtgtagggagagaaagtgggggt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32828994 |
tgtctctcccacaccgaagaagaaacggttgaagttaggaaaggatgtagttccgaagagtgtggagggtgataaaggtgtagggagagaaagtgggggt |
32828895 |
T |
 |
| Q |
213 |
tctggtggtgggaattggagtttgaggtcaagatcgaggggtaagaacgtggaatttgaagtgaaggaggagagggaattgagtggtaggaaaaggaagt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32828894 |
tctggtggtgggaattggagtttgaggtcaagatcgaggggtaagaacgtggaatttgaagtgaaggaggagagggaattgagtggtaggaaaaggaagt |
32828795 |
T |
 |
| Q |
313 |
tgtt |
316 |
Q |
| |
|
|||| |
|
|
| T |
32828794 |
tgtt |
32828791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University