View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17539_high_26 (Length: 270)
Name: NF17539_high_26
Description: NF17539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17539_high_26 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 6449794 - 6450058
Alignment:
| Q |
1 |
accagatacatattctatgcgcgtaactgcaaaaactaatccatcgagttaggtagaatcaaaatcgatggcaaagcactccctcaagagatttaacatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
6449794 |
accagatacatattctatgcgcgtaactgcaaagactaatccatcgagttgggtagaatcaaaatcggtggcaaagtactccctcaagagatttaacatt |
6449893 |
T |
 |
| Q |
101 |
gcttcattctcaaggctgaattcgaacgacaaacatctagttaagctagagtagattcattatcatctcatccaagcactcttggttatactttgatagt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6449894 |
gcttcattctcaaggctgaattcaaacgtcaaacatctagttaagctagagaagattcattatcatctcattcaagcactcttggttatactttgatagt |
6449993 |
T |
 |
| Q |
201 |
tagttatatgggtaaatattcacttttggtactgaatgtgtaactagtagccacgatagctcatcaatat |
270 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| ||||||||||| ||| |||||||||| |
|
|
| T |
6449994 |
tagttatatgggtaaa---tcacttttggtagtgaatgtgt--ctagtagccacaatatttcatcaatat |
6450058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 69 - 127
Target Start/End: Complemental strand, 11052812 - 11052754
Alignment:
| Q |
69 |
tggcaaagcactccctcaagagatttaacattgcttcattctcaaggctgaattcgaac |
127 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| | ||||| |||||||| | |||||| |
|
|
| T |
11052812 |
tggcaaagcattccctcaagagatttaacattgttacattcacaaggctggaatcgaac |
11052754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 127
Target Start/End: Complemental strand, 3765333 - 3765285
Alignment:
| Q |
79 |
ctccctcaagagatttaacattgcttcattctcaaggctgaattcgaac |
127 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| || ||||||||||| |
|
|
| T |
3765333 |
ctccctcaagagatttaacactgctgcattctcagggttgaattcgaac |
3765285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 127
Target Start/End: Original strand, 27997625 - 27997683
Alignment:
| Q |
69 |
tggcaaagcactccctcaagagatttaacattgcttcattctcaaggctgaattcgaac |
127 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||| | ||| ||| |||||||||||||| |
|
|
| T |
27997625 |
tggcaaaacactctctcaagagatttaacattggtgtattttcagggctgaattcgaac |
27997683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University