View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17539_high_34 (Length: 231)
Name: NF17539_high_34
Description: NF17539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17539_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 163421 - 163635
Alignment:
| Q |
1 |
aagatgaatggtaataggtttgtgcatgaattgagaaagcttgttgatgttgactgataagtcaggaaggttgggatttcaatgttgaagagcaccaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
163421 |
aagatgaatggtaataggtttgtgcatgaattgagaaagcttgttgatgttgactgataagtcaggaaggttgggatttaaatgttgaagagcaccaatt |
163520 |
T |
 |
| Q |
101 |
atttgcctatatatggtggagttggtggatactgaagcatcatgtagttgatgttttgctttagttaacagagctatcaatgatgggacataaacagacc |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
163521 |
atttgcctatatgtggtggagttggtggatactgaagcatcatgtagttgatgttttgctttagttaacagagctatcaatgatgggacataaacagacc |
163620 |
T |
 |
| Q |
201 |
atttgatgttggtat |
215 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
163621 |
atttgacattggtat |
163635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 654274 - 654306
Alignment:
| Q |
17 |
ggtttgtgcatgaattgagaaagcttgttgatg |
49 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
654274 |
ggtttgtacatgaattgagaaagcttgttgatg |
654306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University