View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17539_low_23 (Length: 316)
Name: NF17539_low_23
Description: NF17539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17539_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 104 - 305
Target Start/End: Complemental strand, 9381978 - 9381776
Alignment:
| Q |
104 |
attttttaatgtaatttaattaatttagtttatacgcaccaacagccaaacataattgttcgatccatggttgactttagtca-atttaacttaaaaaag |
202 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9381978 |
attttttattgtaatttaaataatttagtttatacgcaccaacagccaaacataattgttcgatccatggttgactttagtcatatttaacttaaaaaag |
9381879 |
T |
 |
| Q |
203 |
atgatgtattatgataggttgattgtgtagaatattttacagtaacaatcaaaattattctcttacatcatcttcttatcttatggtatgtgatgatgtt |
302 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9381878 |
atgatgtattgtgataggttgattgtgtagaatattttacagtaacaatcaaaattattctcttatatcatcttcttatcttatggtatgtgatgatgtt |
9381779 |
T |
 |
| Q |
303 |
ttt |
305 |
Q |
| |
|
||| |
|
|
| T |
9381778 |
ttt |
9381776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 186
Target Start/End: Complemental strand, 9399465 - 9399385
Alignment:
| Q |
105 |
ttttttaatgtaatttaattaatttagtttatacgcaccaacagccaaacataattgttcgatccatggttgactttagtca |
186 |
Q |
| |
|
||||||| | ||||| ||||| |||| |||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9399465 |
ttttttattttaattaaatta-tttaatttatatgcaccaacagccaaacataactgttcgatccatggttgactttagtca |
9399385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University