View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17539_low_30 (Length: 252)
Name: NF17539_low_30
Description: NF17539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17539_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 2 - 244
Target Start/End: Original strand, 2355236 - 2355478
Alignment:
| Q |
2 |
agtagagagatttaccgcatttgcatcgtgattgtcaatgcctgggattgatgtaacaactttaaggtaaaagttcattccttgcaccaactgcttcctc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2355236 |
agtagagagatttaccgcatttgcatcgtgattgtcaatgcctgggattgatgtaacaactttaaggtaaaagttcattccttgcaccaactgcttcctc |
2355335 |
T |
 |
| Q |
102 |
ttcaaaaccataacaaaatttaaacatcaatttgctagtttcacttcatatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatga |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2355336 |
ttcaaaaccataacaaaattcaaacatcaatttgctagtttcacttcatatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatga |
2355435 |
T |
 |
| Q |
202 |
gctgacctcacctcagccttcagtttttcttcaattctctgct |
244 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2355436 |
gctgacctcacctcagctttcagtttttcttcaattctctgct |
2355478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 116 - 244
Target Start/End: Complemental strand, 2222689 - 2222561
Alignment:
| Q |
116 |
aaaatttaaacatcaatttgctagtttcacttcatatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatgagctgacctcacctc |
215 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222689 |
aaaattcaaacatcaatttgctagtttcacttcatatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatgagctgacctcacctc |
2222590 |
T |
 |
| Q |
216 |
agccttcagtttttcttcaattctctgct |
244 |
Q |
| |
|
||| ||||||||||||||||||||||||| |
|
|
| T |
2222589 |
agctttcagtttttcttcaattctctgct |
2222561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University