View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17539_low_35 (Length: 245)
Name: NF17539_low_35
Description: NF17539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17539_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 41090288 - 41090092
Alignment:
| Q |
1 |
agccgaggatcgaaatcccaaatgaatgttgctggtattcataaacaaaaacatgtgtagtctatagatctgccaattcaatgcagctaggaagaagtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41090288 |
agccgaggatcgaaatcccaaatgaatgttgctgctattcataaacaaaaacatgtgtagtctatagatctgcgaattcaatgcagctaggaagaagtca |
41090189 |
T |
 |
| Q |
101 |
gcaaaacaatgaatatatatgccaaaaatggtttcttggccttatctctccttccacatccttgtcattgatctggaagggattaatttaaagcatt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41090188 |
gcaaaacaatgaatatatatgccaaaaatggtttcttggccttatctctccttccacatccttgtcattgatctggaagggattaatttaaagcatt |
41090092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University