View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17539_low_41 (Length: 218)
Name: NF17539_low_41
Description: NF17539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17539_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 6e-64; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 34754341 - 34754464
Alignment:
| Q |
1 |
tgaatcttacctcttgttcttttctgctgctataacagtcaaggtatagactgctaattgctggtgaagatgatgagtcttctgatgaagaattgaatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34754341 |
tgaatcttacctcttgttcttttctgctgctataacagtcaaggtatagactgctaattgctggtgaagatgatgagtcttctgatgaagaattgaatgg |
34754440 |
T |
 |
| Q |
101 |
tgttttcatggatgaacacgacga |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34754441 |
tgttttcatggatgaacacgacga |
34754464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 123 - 216
Target Start/End: Original strand, 34754505 - 34754598
Alignment:
| Q |
123 |
gaggatgcaggagttctagctgacccggactacaatcctgatatggatgaaaatttcagtgatggtggcagcaacagcagcagtagtagtagta |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34754505 |
gaggatccaggagttctagctgacccggactacaatcctgatatggatgaaaatttcagtgatggtggcagcaacagcagcagtagtagtagta |
34754598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 128
Target Start/End: Original strand, 11538121 - 11538217
Alignment:
| Q |
35 |
acagtcaaggtatagactgctaattgctggtgaagatgatgagtcttctgatgaagaa----ttgaatggtgttttcatggatgaacacgacgaggat |
128 |
Q |
| |
|
|||||||||||||||| || | ||||| ||||||||| |||| ||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| |
|
|
| T |
11538121 |
acagtcaaggtatagattgttgattgccggtgaagataatgaatcttctgatgaggaattcgttgaa-ggcgtttttatggatgaacacgacgaggat |
11538217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 128
Target Start/End: Original strand, 11563631 - 11563727
Alignment:
| Q |
35 |
acagtcaaggtatagactgctaattgctggtgaagatgatgagtcttctgatgaagaa----ttgaatggtgttttcatggatgaacacgacgaggat |
128 |
Q |
| |
|
|||||||||||||||| || | ||||| ||||||||| |||| ||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| |
|
|
| T |
11563631 |
acagtcaaggtatagattgttgattgccggtgaagataatgaatcttctgatgaggaattcgttgaa-ggcgtttttatggatgaacacgacgaggat |
11563727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University