View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17539_low_42 (Length: 209)
Name: NF17539_low_42
Description: NF17539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17539_low_42 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 51034216 - 51034008
Alignment:
| Q |
1 |
caatacaagttttgcacttcttgatgatatatcaattacttattagacctatccatccgtattagtcaatttagatacttttgggggttttgattttaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51034216 |
caatacaagttttgcacttcttgatgatatatcaattacttattagacctatccatccgtattagtcaatttagatacttttgggggttttgattttaac |
51034117 |
T |
|
| Q |
101 |
ttggaaattgaagcattcacttgggtgttcctaaatctaggtgcggaagatcctaggtgtcccctagccggcttggaaattccgagggcaaaagcaacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
51034116 |
ttggaaattgaagcattcacttgggtgttcctaaatctaggtgcggaagatcctaggtgtcccctagccggcttggaaattccgagggcaaaagcaagca |
51034017 |
T |
|
| Q |
201 |
aggcatacg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
51034016 |
aggcatacg |
51034008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 51041210 - 51041139
Alignment:
| Q |
1 |
caatacaagttttgcacttcttgatgatatatcaattacttattagacctatccatccgtattagtcaattt |
72 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||| ||| ||||||| ||||||| |
|
|
| T |
51041210 |
caatacaagttttgcacttcttaattatatatcaattacttattagacctatgcatacgtattaatcaattt |
51041139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 127 - 197
Target Start/End: Complemental strand, 51041126 - 51041056
Alignment:
| Q |
127 |
gttcctaaatctaggtgcggaagatcctaggtgtcccctagccggcttggaaattccgagggcaaaagcaa |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| || ||||| ||||| ||||| ||||||||||||| |
|
|
| T |
51041126 |
gttcctaactctaggtgcggaagatcctaggtgtcctcttgccggattggagattccaagggcaaaagcaa |
51041056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University