View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1753_low_4 (Length: 252)
Name: NF1753_low_4
Description: NF1753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1753_low_4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 29659975 - 29659734
Alignment:
| Q |
11 |
catagggcatgtggggtcaaatttatgttaatgttaaaaaacgtagtcgagtgtaagaagatgatagtaccaatcatgatgaacaaggaaagaagacaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29659975 |
catagggcatgtggggtcaaatttatgttaatgttaaaaaacgtagtcgagtgtaagaagatgatagtaccaatcatgatgaacaaggaaagaagacaaa |
29659876 |
T |
 |
| Q |
111 |
ggtggaattgggacgaggctctacaagcaaggacgcaccaaatattatgctatcctaatcagaccattatttatatttcatggcatgtcattggttcctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29659875 |
ggtggaattgggacgaggctctacaagcaaggacgcaccaaatattatgctatcctaatcagaccattatttatatttcatggcatgtcattggttcctt |
29659776 |
T |
 |
| Q |
211 |
gtacctaaagccatagatttcgtgctacacttttttcttttc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29659775 |
gtacctaaagccatagatttcgtgctacacttttttcttttc |
29659734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University