View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1753_low_7 (Length: 248)
Name: NF1753_low_7
Description: NF1753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1753_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 40553712 - 40553934
Alignment:
| Q |
19 |
gagtgtccatgttatgcattttcttatggcctatctcctgcatcttcaagtattcgaatttgcaaacttgacaaagattttatgtataatctttcaaagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40553712 |
gagtgtccatgttatgcattttcttatggcctatctcctgcatcttcaagtattcgaatttgcaaacttgacaaagattttatgtataatctttcaaagc |
40553811 |
T |
|
| Q |
119 |
acattaaagcaaaatatgtggaaccaatatatgtttttaaagggtcgatgaacaatattccgttgaagcttggatatctttctgttgaattgtgtaaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40553812 |
acattaaagcaaaatatgtggaaccaatatatgtttttaaagggtcgatgaacaatattccgctgaagctcggatatctttctgttgaattgtgtaaatt |
40553911 |
T |
|
| Q |
219 |
ggtgagcatttttgttgatgatg |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40553912 |
ggtgagcatttttgttgatgatg |
40553934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University