View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17540_low_10 (Length: 473)
Name: NF17540_low_10
Description: NF17540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17540_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 130 - 398
Target Start/End: Original strand, 2114653 - 2114921
Alignment:
| Q |
130 |
atctattgctattgttagagctgcggtgcagtggcttagttacaggctcggtatcatttcaaatgcattagaagtgaactgcagactgcagtggtggtgt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2114653 |
atctattgctattgttagagctgcggtgcagtggcttagttacaggctcggtatcatttcaaatgcattagaagtcaactgcagactgcagtggtggtgt |
2114752 |
T |
|
| Q |
230 |
ttacttagttcaatggatgtttgttctgtggtcacgtgatgatgtccacaatgttgtattagaactacaaggtatactagtaaggctcacattgctcgag |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2114753 |
ttacttagttcaatggatgtttgttctgtggtcacgtgatgatgtccacaatgttgtattagaactacaaggtatactagtaaggctcactttgctcgag |
2114852 |
T |
|
| Q |
330 |
ttttgcttgaaagaattttgcttccaattgagagagatgtcatagattcgatgcacaaagattatggag |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||| |
|
|
| T |
2114853 |
ttttgcttgaaagaattttgcttccaattgagagagatgtcatagattcaatcaacaaagattctggag |
2114921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 24 - 131
Target Start/End: Original strand, 2114249 - 2114353
Alignment:
| Q |
24 |
caaagagaacaacacaaaagataaaatatcat-aaaattttaaaaaagaaccagtcatattcttacaatatataattccataacaatgttctttttggga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2114249 |
caaagagaacaacacaaaagataaaatatcataaaaattttaaaaaagatcgagtcatattcttaca----ataattccataacaatgttctttttggga |
2114344 |
T |
|
| Q |
123 |
tgttattat |
131 |
Q |
| |
|
||||||||| |
|
|
| T |
2114345 |
tgttattat |
2114353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University