View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17540_low_13 (Length: 332)
Name: NF17540_low_13
Description: NF17540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17540_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 2 - 237
Target Start/End: Complemental strand, 15183869 - 15183631
Alignment:
| Q |
2 |
ttttatgttggtgatattcttcagcttatggatatgtaccaggactcatttctcattcaagttcaaaatgaattgcatct---tttgtgttgttttcttt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
15183869 |
ttttatgttggtgatattcttcagcttatggatatgtaccaggactcatttctcattcaagttcaaattgaattgcatctaattttgtgttgttttcttt |
15183770 |
T |
|
| Q |
99 |
cttataattaagnnnnnnnnnnnnnnnnnnnngagttggtataacatcctctaacaaataatcaagtattcaatcatagcttaactagaaatactccatc |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15183769 |
cttataattaagaaaaaaattcaagaaaaaaagagttggtataacatcctctaacaaataatcaagtattcaatcatagcttaactagaaatactccatc |
15183670 |
T |
|
| Q |
199 |
acaatcttaattttttttggttacaaggcaaatgaaagg |
237 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15183669 |
acaatcttatttttttttggttacaaggcaaatgaaagg |
15183631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 15183590 - 15183549
Alignment:
| Q |
282 |
ggaactactctatagaaaagagagttcaagccgcgttcatct |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15183590 |
ggaactactctatagaaaagagagttcaagccgcgttcatct |
15183549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University